In December 2019, a new coronavirus (SARS-CoV-2) was discovered due to atypical viral pneumonia cases (COVID-19) in Wuhan. In early January 2020, Synbio Technologies designed and synthesized detection probes for COVID-19 based on our independently developed Syno® qPCR primer/probe design and synthesis platform. In less than two weeks, we completed the synthesis of detection reagent materials, such as amplification primers, probes, and quality controls.

Competitive Advantages

  • Speed guarantee: All COVID-19 related orders will be given priority to green channel production, with 24/7 professional online support.
  • Quality assurance: ISO 13485 standards of manufacturing, referring to the latest US CDC standards,providing reagents designed with WHO and China CDC standards as well. Low product false positive rate,more cost-effective under the premise of ensuring the quality.
  • Production capacity: Experienced synthesis experts, first in class instruments, more than one million probe kit materials supplied per day.
  • Product supply: All in one, all 4 sets of primer and probes are included, more scientific and accurate. Virus-related N protein,S protein and other related products are available in stock. 

Probe/Primer Synthesis for Virus Detection

According to the official website documents of WHO and China&US CDC, Synbio Technologies has prepared a series of primers and probe materials for COVID-19 detection in batches. We can provide a free trial package and guarantee the supply of a million copies of nucleic acid diagnostic probes daily to speed up disease detection and research.

To help facilitate COVID-19 research and contribute to fight the virus, Synbio Technologies currently has manufactured a detection assay based on CDC Real-Time R T-PCR protocol of detection 2019-novel coronavirus. This assay has successfully detected SARS-CoV-2 in positive control samples N gene and human RNAse P (RNP) gene to assess the specimen quality. It should be considered for research use only (RUO).

SARS-CoV-2 Real Time RT-PCR Detection Assay Specifications
Catalog# SYN202000, this assay kit includes Box #1 and Box #2.
Box #1: Primers and Probes

Reagent Label Part # Description Quantity /Tube Reactions /Tube Price
SARS-CoV-2_N1 ST202001 SARS-CoV-2_N1 Combined Primer/Probe Mix 37.5 µL/0.56 nmol 25 $229/Kit *
SARS-CoV-2_N2 ST202002 SARS-CoV-2_N2 Combined Primer/Probe Mix 37.5 µL/0.56 nmol 25
SARS-CoV-2_N3 ST202003 SARS-CoV-2_N3 Combined Primer/Probe Mix 37.5 µL/0.56 nmol 25
RP ST202004 Human RNase P Forward Primer/Probe Mix 37.5 µL/0.56 nmol 25
2X Reaction Buffer ST202006 Buffer, dNTP 1.2ml 100
Enzymes Mix ST202007 UDG, Taq DNA Polymerase, Reverse Transcriptase, RNase inhibitor 200µL 100
Nuclease-free Water ST202008 Nuclease-free Water 1.5ml 100

* Each part above can be sold separately, please contact us at service@synbio-tech.com.

Box #2: Positive Control

Reagent Label Part # Descriptions Quantity Note Price
SARS-CoV-2 Positive Control(Plasmid DNA) ST202005 The assays target regions within the SARS-CoV-2 nucleocapsid gene which is present in the SARS-CoV-2_N Positive Control plasmid. The Hs_RPP30 Control contains a portion of the RPP30 gene, a gene present in the human genome. 125 µL/1 tube Providing (25) 5 µL test reactions Price included *

* Positive Control Plasmid DNA included in Detection Assay Kit, $50 if sold separately.

 

Features

  • Based on CDC protocol, ISO 13485 standards of manufacturing reagents.
  • TaqMan™ Real-Time RT-PCR assay primers and FAM probes for higher specificity.
  • Targeting three targeted sequence of N gene in GenBank sequences NC_045512.2.
  • Positive control included already, no extra preparation required.

Statements

  • This assay is for Research Use Only (RUO) and has not been tested on clinical samples.
  • This assay is designed based on CDC protocol and public SARS-CoV-2 genome sequences.
  • Different sample extraction methods, sample quality, operation parameters, data processing and other un-tested factors might impact this assay’s performance.
  • Stability tests and data are not available now due to the emergency. More information will be updated when those are ready.

Certificate of Analysis and Protocol

 

Primer/Probe Set for WHO

Catalog# SYN20200100, this set includes primers/probes of RdRp, E and N genes.

Name Part # Description Oligonucleotide Sequence (5’>3’) Length Fluorophores/Quencher Price
RdRP gene ST20200101 Primer RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGG 22   100rxn/part, $30/set; 500rxn/part, $60/set
ST20200102 Primer RdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATA 26  
ST20200103 Probe RdRP_SARSr-P2 CAGGTGGAACCTCATCAGGAGATGC 25 FAM/BHQ1
ST20200104 Probe RdRP_SARSr-P1 CCAGGTGGWACRTCATCMGGTGATGC 26 FAM/BHQ1
E gene ST20200105 Primer E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT 26  
ST20200106 Primer E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA 22  
ST20200107 Probe E_Sarbeco_P1 ACACTAGCCATCCTTACTGCGCTTCG 26 FAM/BHQ1
N gene ST20200108 N_Sarbeco_F1 CACATTGGCACCCGCAATC 19  
ST20200109 N_Sarbeco_R1 GAGGAACGAGAAGAGGCTTG 20  
ST20200110 N_Sarbeco_P1 ACTTCCTCAAGGAACAACATTGCCA 25 FAM/BHQ1

* Each part above can be sold separately, please contact us at service@synbio-tech.com.

Data Sheet and Instruction for Use

Primer/Probe Set for China CDC

Catalog# SYN20200200, this set includes primers/probes of Target 1(ORF1ab) and Target2(N).

Name Part # Description Oligonucleotide Sequence (5’>3’) Length Fluorophores/Quencher Price
Target 1 (ORF1ab) ST20200201 Forward Primer 1ab CCCTGTGGGTTTTACACTTAA 21 100rxn/part, $20/set; 500rxn/part, $40/set
ST20200202 Reverse Primer 1ab ACGATTGTGCATCAGCTGA 19
ST20200203 Probe 1ab CCGTCTGCGGTATGTGGAAAGGTTATGG 28 FAM/BHQ1
Target 2(N) ST20200204 Forward Primer N GGGGAACTTCTCCTGCTAGAAT 22
ST20200205 Reverse Primer N CAGACATTTTGCTCTCAAGCTG 22
ST20200206 Probe N TTGCTGCTGCTTGACAGATT 20 FAM/BHQ1

* Each part above can be sold separately, please contact us at service@synbio-tech.com.

Primer/Probe Set for US CDC

Catalog# SYN20200300, this set includes primers/probes of RP gene and 2019-nCOV N1/2/3 gene.

Name Part # Description Oligonucleotide Sequence (5’>3’) Length Fluorophores/Quencher Price
RP-F ST20200301 RNase P Forward Primer AGATTTGGACCTGCGAGCG 19   100rxn/part, $40/set;
500rxn/part, $80/set
RP-R ST20200302 RNase P Reverse Primer GAGCGGCTGTCTCCACAAGT 20  
RP-P ST20200303 RNase P Probe TTCTGACCTGAAGGCTCTGCGCG 23 FAM/BHQ1
2019-nCoV_N1-F ST20200304 2019-nCoV_N1 Forward Primer GACCCCAAAATCAGCGAAAT 20  
2019-nCoV_N1-R ST20200305 2019-nCoV_N1 Reverse Primer TCTGGTTACTGCCAGTTGAATCTG 24  
2019-nCoV_N1-P ST20200306 2019-nCoV_N1 Probe ACCCCGCATTACGTTTGGTGGACC 24 FAM/BHQ1
2019-nCoV_N2-F ST20200307 2019-nCoV_N2 Forward Primer TTACAAACATTGGCCGCAAA 20  
2019-nCoV_N2-R ST20200308 2019-nCoV_N2 Reverse Primer GCGCGACATTCCGAAGAA 18  
2019-nCoV_N2-P ST20200309 2019-nCoV_N2 Probe ACAATTTGCCCCCAGCGCTTCAG 23 FAM/BHQ1
2019-nCoV_N3-F ST20200310 2019-nCoV_N3 Forward Primer GGGAGCCTTGAATACACCAAAA 22  
2019-nCoV_N3-R ST20200311 2019-nCoV_N3 Reverse Primer TGTAGCACGATTGCAGCATTG 21  
2019-nCoV_N3-P ST20200312 2019-nCoV_N3 Probe AYCACATTGGCACCCGCAATCCTG 24 FAM/BHQ1
* Each part above can be sold separately, please contact us at service@synbio-tech.com.

Data Sheet and Instruction for Use

Synbio Technologies has obtained the following viral RNA through in vitro transcription and prepared positive controls, which is helpful to control the reverse transcription efficiency, achieve the unification of standards, reduce the false negative rate, make the detection results more reliable, and greatly improve the accuracy of the kit detection degree.

Name Cat # Description Transcription Sequence Price (50 rxn)
RdRP gene SYN20200401 RdRP standards GTGAAATGGTCATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGA GATGCCACAACTGCTTATGCTAATAGTGTTTTTAACATTTG $50
E gene SYN20200402 E gene standards ACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTA TTCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATAT $50
Target 1 (ORF1ab) SYN20200403 ORF1ab standards CCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTAT GGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATGCACAATCGT $50
Target 2 (N) SYN20200404 N standards GGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGC TGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTG $50
Endogenous control SYN20200405 RNase P AGATTTGGACCTGCGAGCGGGTTCTGACCTGAAGGCTCTGCGCGGACTTG TGGAGACAGCCGCTC $50

*The above figure shows the sample map of COVID-19 gene RNA extracted by Synbio Technologies
(N-gene part, ORF1ab, E-gen part, RdRP gene part).

*Sequences above were collected from WHO, US CDC and China CDC official website documents. Synbio Technologies’ related products have been added with RNase P, which meets the double detection standard and can greatly reduce the “false negative” phenomenon in the nucleic acid detection process and improve the detection accuracy.

More COVID-19 DNA Solutions

Related